Transcript: Mouse XM_006524562.3

PREDICTED: Mus musculus cDNA sequence BC051142 (BC051142), transcript variant X18, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
BC051142 (407788)
Length:
2273
CDS:
627..2006

Additional Resources:

NCBI RefSeq record:
XM_006524562.3
NBCI Gene record:
BC051142 (407788)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006524562.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000253968 GAACCAAGACGGGATAGTAAT pLKO_005 1757 CDS 100% 13.200 18.480 N BC051142 n/a
2 TRCN0000253965 TGAGGGATCCAACGCTGTAAT pLKO_005 1169 CDS 100% 13.200 18.480 N BC051142 n/a
3 TRCN0000253969 CAGACACCTTGCCCTTATTAA pLKO_005 1324 CDS 100% 15.000 10.500 N BC051142 n/a
4 TRCN0000253966 CCCGGTGCATCATGGTTATAA pLKO_005 2085 3UTR 100% 15.000 10.500 N BC051142 n/a
5 TRCN0000253967 GTATCGGAGATGACCAAATAA pLKO_005 1450 CDS 100% 15.000 10.500 N BC051142 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006524562.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.