Transcript: Mouse XM_006527320.3

PREDICTED: Mus musculus heterogeneous nuclear ribonucleoprotein U-like 2 (Hnrnpul2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Hnrnpul2 (68693)
Length:
2511
CDS:
441..2426

Additional Resources:

NCBI RefSeq record:
XM_006527320.3
NBCI Gene record:
Hnrnpul2 (68693)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006527320.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000241135 TGATGTGCCTGAGTCTATAAT pLKO_005 2180 CDS 100% 15.000 21.000 N Hnrnpul2 n/a
2 TRCN0000245369 CGATTCTACAGTCGAGATTAT pLKO_005 2458 3UTR 100% 13.200 18.480 N Hnrnpul2 n/a
3 TRCN0000241136 TGCCTGAGAAATGCGACTATA pLKO_005 2227 CDS 100% 13.200 10.560 N Hnrnpul2 n/a
4 TRCN0000241133 TGGGTGTGGCATTCCGAATTA pLKO_005 1582 CDS 100% 13.200 9.240 N Hnrnpul2 n/a
5 TRCN0000230596 TTGTGAACCTGGACACGTATA pLKO_005 1168 CDS 100% 10.800 7.560 N HNRNPUL2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006527320.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.