Transcript: Mouse XM_006527333.2

PREDICTED: Mus musculus lipase, family member N (Lipn), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Lipn (70166)
Length:
2710
CDS:
411..1613

Additional Resources:

NCBI RefSeq record:
XM_006527333.2
NBCI Gene record:
Lipn (70166)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006527333.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000251673 TATGACCTCCCAGGGATAATA pLKO_005 861 CDS 100% 15.000 21.000 N Lipn n/a
2 TRCN0000251675 CTACGCTACTTCAAGCAATTT pLKO_005 1500 CDS 100% 13.200 10.560 N Lipn n/a
3 TRCN0000251674 TACTAGCAGATGCAGGTTATG pLKO_005 733 CDS 100% 10.800 8.640 N Lipn n/a
4 TRCN0000251672 AGGATGTCATTTATCACATTC pLKO_005 1134 CDS 100% 10.800 7.560 N Lipn n/a
5 TRCN0000251676 TTTGATACCTGGAACCTTAAG pLKO_005 446 CDS 100% 10.800 7.560 N Lipn n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006527333.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.