Transcript: Mouse XM_006528196.3

PREDICTED: Mus musculus DNA segment, Chr X, Baylor 18 (DXBay18), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
DXBay18 (574405)
Length:
2969
CDS:
704..2791

Additional Resources:

NCBI RefSeq record:
XM_006528196.3
NBCI Gene record:
DXBay18 (574405)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006528196.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000270422 ATTCGACAAGACCATCTTAAA pLKO_005 2704 CDS 100% 13.200 6.600 Y Gm5640 n/a
2 TRCN0000284446 CGCTGGTCTGGTTCAAATTTC pLKO_005 1854 CDS 100% 13.200 6.600 Y Gm14685 n/a
3 TRCN0000284443 TAGACAAGTCTGAAATCATAA pLKO_005 879 CDS 100% 13.200 6.600 Y Gm14685 n/a
4 TRCN0000255113 TATTCGACAAGACCATCTTAA pLKO_005 2703 CDS 100% 13.200 6.600 Y DXBay18 n/a
5 TRCN0000270485 TTCGACAAGACCATCTTAAAG pLKO_005 2705 CDS 100% 13.200 6.600 Y Gm5936 n/a
6 TRCN0000255114 AGGAGACAAAGTGAGGTTTAC pLKO_005 2560 CDS 100% 10.800 5.400 Y DXBay18 n/a
7 TRCN0000270691 CTACCGTGAGAAAGAGCTATT pLKO_005 2686 CDS 100% 10.800 5.400 Y Gm14685 n/a
8 TRCN0000270633 GGCGACCTGCATATCGATTTC pLKO_005 2195 CDS 100% 10.800 5.400 Y Gm14685 n/a
9 TRCN0000255115 GGGCGACCTGCATATCGATTT pLKO_005 2194 CDS 100% 10.800 5.400 Y DXBay18 n/a
10 TRCN0000255116 TACACCACCCAAGCCAGTTAC pLKO_005 2150 CDS 100% 10.800 5.400 Y DXBay18 n/a
11 TRCN0000255117 TCGTGGACTTCATCGTGAAGA pLKO_005 2340 CDS 100% 4.950 2.475 Y DXBay18 n/a
12 TRCN0000270631 CCAAGACAGGAGACAGGAAGT pLKO_005 2831 3UTR 100% 4.050 2.025 Y Gm14685 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006528196.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.