Transcript: Mouse XM_006528255.3

PREDICTED: Mus musculus DMRT-like family C1c2 (Dmrtc1c2), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dmrtc1c2 (668357)
Length:
1531
CDS:
305..1006

Additional Resources:

NCBI RefSeq record:
XM_006528255.3
NBCI Gene record:
Dmrtc1c2 (668357)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006528255.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000267449 GATAGCACTGTGCAATTTAAT pLKO_005 1342 3UTR 100% 15.000 7.500 Y Dmrtc1c1 n/a
2 TRCN0000252748 CCCACGGGTCTCAAGTGTATT pLKO_005 687 CDS 100% 13.200 6.600 Y Dmrtc1c1 n/a
3 TRCN0000265694 TGGAGCAGCAGCACCTGTAAT pLKO_005 376 CDS 100% 13.200 6.600 Y Dmrtc1c2 n/a
4 TRCN0000252750 ATCCTCAGAGGACGTGCAAAT pLKO_005 404 CDS 100% 10.800 5.400 Y Dmrtc1c1 n/a
5 TRCN0000255789 CCACGGGTCTCAAGTGTATTG pLKO_005 688 CDS 100% 10.800 5.400 Y Dmrtc1c2 n/a
6 TRCN0000252751 GAGGAAAGAGACGCCAGATTC pLKO_005 525 CDS 100% 10.800 5.400 Y Dmrtc1c1 n/a
7 TRCN0000252749 TCCAACCCATGCTCAAGTATG pLKO_005 809 CDS 100% 10.800 5.400 Y Dmrtc1c1 n/a
8 TRCN0000265699 TCCTCAGAGGACGTGCAAATC pLKO_005 405 CDS 100% 10.800 5.400 Y Dmrtc1c2 n/a
9 TRCN0000255790 TTTGTAAGCCTTCGGGCATTT pLKO_005 1204 3UTR 100% 10.800 5.400 Y Dmrtc1c2 n/a
10 TRCN0000255788 GGGTATAGTGCACGAGGAAAG pLKO_005 512 CDS 100% 6.000 3.000 Y Dmrtc1c2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006528255.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.