Transcript: Mouse XM_006531369.2

PREDICTED: Mus musculus RIKEN cDNA 4933405L10 gene (4933405L10Rik), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
4933405L10Rik (71046)
Length:
1189
CDS:
144..1040

Additional Resources:

NCBI RefSeq record:
XM_006531369.2
NBCI Gene record:
4933405L10Rik (71046)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006531369.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000267086 TAGTGCCACTGACCCATAATC pLKO_005 850 CDS 100% 13.200 18.480 N 4933405L10Rik n/a
2 TRCN0000267084 CTACGTCATCCATCGTGAGAC pLKO_005 403 CDS 100% 4.050 5.670 N 4933405L10Rik n/a
3 TRCN0000267082 CTGGGCTTAGGCCTTGCTTTA pLKO_005 813 CDS 100% 10.800 8.640 N 4933405L10Rik n/a
4 TRCN0000267083 TGTACCAATACATCAACTACT pLKO_005 655 CDS 100% 4.950 3.960 N 4933405L10Rik n/a
5 TRCN0000267085 AGAAGGCAGCCACAGTGAATC pLKO_005 494 CDS 100% 10.800 6.480 N 4933405L10Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006531369.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.