Transcript: Mouse XM_006533217.3

PREDICTED: Mus musculus dynein, axonemal, heavy chain 9 (Dnah9), transcript variant X8, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dnah9 (237806)
Length:
10542
CDS:
96..10310

Additional Resources:

NCBI RefSeq record:
XM_006533217.3
NBCI Gene record:
Dnah9 (237806)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006533217.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000267425 CACGAGTCAAGTCGGGTTTAT pLKO_005 4974 CDS 100% 13.200 18.480 N Dnah9 n/a
2 TRCN0000252623 TGCGGTGAAGCAGTCAATTAG pLKO_005 5864 CDS 100% 13.200 18.480 N Dnah9 n/a
3 TRCN0000252621 GACCTATGCCATGCGAGATTT pLKO_005 8435 CDS 100% 13.200 9.240 N Dnah9 n/a
4 TRCN0000252622 TGGGTGGTGGGTGATAGATTA pLKO_005 10371 3UTR 100% 13.200 9.240 N Dnah9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006533217.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.