Transcript: Mouse XM_006535903.3

PREDICTED: Mus musculus dehydrogenase/reductase (SDR family) X chromosome (Dhrsx), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dhrsx (236082)
Length:
1177
CDS:
478..1113

Additional Resources:

NCBI RefSeq record:
XM_006535903.3
NBCI Gene record:
Dhrsx (236082)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006535903.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000251533 TGTGAACTTCCTGGGCCACTT pLKO_005 552 CDS 100% 4.050 2.835 N Dhrsx n/a
2 TRCN0000251532 ACTGCGGACAGGAAGTTGTCA pLKO_005 440 5UTR 100% 3.000 2.100 N Dhrsx n/a
3 TRCN0000251535 GTGACCCTGTGACCTCCAACA pLKO_005 794 CDS 100% 1.350 0.945 N Dhrsx n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006535903.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.