Transcript: Mouse XM_006538816.2

PREDICTED: Mus musculus predicted gene 572 (Gm572), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gm572 (230909)
Length:
2911
CDS:
16..2238

Additional Resources:

NCBI RefSeq record:
XM_006538816.2
NBCI Gene record:
Gm572 (230909)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006538816.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000268292 ATTGTCAGCATACCGTCAATG pLKO_005 793 CDS 100% 10.800 8.640 N Gm572 n/a
2 TRCN0000268293 AGCAGAGCGATCGCTACATAA pLKO_005 422 CDS 100% 13.200 9.240 N Gm572 n/a
3 TRCN0000268240 GTCCGTTGTCATCCCTCATTC pLKO_005 484 CDS 100% 10.800 7.560 N Gm572 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006538816.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.