Transcript: Mouse XM_006539271.1

PREDICTED: Mus musculus MORN repeat containing 1 (Morn1), transcript variant X13, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Morn1 (76866)
Length:
1528
CDS:
358..1335

Additional Resources:

NCBI RefSeq record:
XM_006539271.1
NBCI Gene record:
Morn1 (76866)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006539271.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000253364 AGTTACTACGAAGGCGAATTT pLKO_005 195 5UTR 100% 13.200 18.480 N Morn1 n/a
2 TRCN0000253366 CGAAACGGCTATGGCGTATAT pLKO_005 87 5UTR 100% 13.200 18.480 N Morn1 n/a
3 TRCN0000253365 GCCGTGGGCAGATGATCTTTA pLKO_005 334 5UTR 100% 13.200 18.480 N Morn1 n/a
4 TRCN0000253367 ACTCTTGGCTGTTGGACATAA pLKO_005 1346 3UTR 100% 13.200 9.240 N Morn1 n/a
5 TRCN0000265400 CACTGCCCAGGAACCTCTAAA pLKO_005 1116 CDS 100% 13.200 9.240 N Morn1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006539271.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.