Transcript: Mouse XM_006540959.3

PREDICTED: Mus musculus FANCD2/FANCI-associated nuclease 1 (Fan1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fan1 (330554)
Length:
3437
CDS:
638..2791

Additional Resources:

NCBI RefSeq record:
XM_006540959.3
NBCI Gene record:
Fan1 (330554)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006540959.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000242203 AGACGATACTTAAACGCTAAA pLKO_005 1121 CDS 100% 10.800 15.120 N Fan1 n/a
2 TRCN0000242206 AGGCTCTTTCAACGTAAATTA pLKO_005 1904 CDS 100% 15.000 12.000 N Fan1 n/a
3 TRCN0000242205 GCCTGCTCAGGCTGGATTAAT pLKO_005 865 CDS 100% 15.000 10.500 N Fan1 n/a
4 TRCN0000242202 GGAAGTCTGACATCGAAATTG pLKO_005 1097 CDS 100% 13.200 9.240 N Fan1 n/a
5 TRCN0000242204 TCTCGTCAGTAACACGAAATC pLKO_005 1441 CDS 100% 10.800 7.560 N Fan1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006540959.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.