Transcript: Human XM_006716618.3

PREDICTED: Homo sapiens fer-1 like family member 6 (FER1L6), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FER1L6 (654463)
Length:
5972
CDS:
104..5707

Additional Resources:

NCBI RefSeq record:
XM_006716618.3
NBCI Gene record:
FER1L6 (654463)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006716618.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000262871 GACCCAGATCCTCGCCATATA pLKO_005 5720 3UTR 100% 13.200 18.480 N FER1L6 n/a
2 TRCN0000262872 GGACGGGCACAGGAATCTAAA pLKO_005 1355 CDS 100% 13.200 18.480 N FER1L6 n/a
3 TRCN0000262868 CACGTCCAAACCCACCGAAAT pLKO_005 4549 CDS 100% 10.800 15.120 N FER1L6 n/a
4 TRCN0000262870 CCAGTATTTGGAAGGTCATTT pLKO_005 4340 CDS 100% 13.200 9.240 N FER1L6 n/a
5 TRCN0000262869 TTGACTGGTGGTCTAAGTATT pLKO_005 3765 CDS 100% 13.200 9.240 N FER1L6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006716618.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.