Transcript: Human XM_006723651.2

PREDICTED: Homo sapiens SEL1L2 adaptor subunit of ERAD E3 ligase (SEL1L2), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SEL1L2 (80343)
Length:
1947
CDS:
88..1860

Additional Resources:

NCBI RefSeq record:
XM_006723651.2
NBCI Gene record:
SEL1L2 (80343)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006723651.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000247659 ACGCATTTGCTCCGGGATATC pLKO_005 1829 CDS 100% 10.800 8.640 N SEL1L2 n/a
2 TRCN0000247660 CAAGCTAAGGCACTGATATAT pLKO_005 682 CDS 100% 15.000 10.500 N SEL1L2 n/a
3 TRCN0000247662 GGACCACACTGGGACTTATTT pLKO_005 1907 3UTR 100% 15.000 10.500 N SEL1L2 n/a
4 TRCN0000247661 ATAACAGCAGCTATCCAATTA pLKO_005 574 CDS 100% 13.200 9.240 N SEL1L2 n/a
5 TRCN0000247658 GAACAAAGAACATCTAGTAAT pLKO_005 244 CDS 100% 13.200 9.240 N SEL1L2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006723651.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.