Transcript: Mouse XM_011238564.3

PREDICTED: Mus musculus regulatory factor X 8 (Rfx8), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Rfx8 (619289)
Length:
2046
CDS:
527..1882

Additional Resources:

NCBI RefSeq record:
XM_011238564.3
NBCI Gene record:
Rfx8 (619289)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011238564.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000229511 CAATAAGCTTGTCCAGGTATT pLKO_005 1681 CDS 100% 10.800 15.120 N Rfx8 n/a
2 TRCN0000229510 TCGGAATGTGCAAGCCGGAAT pLKO_005 1550 CDS 100% 4.050 5.670 N Rfx8 n/a
3 TRCN0000218187 AGAGGTTTGTGATCCACATAT pLKO_005 1785 CDS 100% 13.200 9.240 N Rfx8 n/a
4 TRCN0000229509 CATCTGCTGCTCTTGGAATAT pLKO_005 1391 CDS 100% 13.200 9.240 N Rfx8 n/a
5 TRCN0000229512 TGGGACAAGAGGCCCTCATAA pLKO_005 1749 CDS 100% 13.200 9.240 N Rfx8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011238564.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.