Transcript: Mouse XM_011239542.2

PREDICTED: Mus musculus l(3)mbt-like (Drosophila) (L3mbtl1), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
L3mbtl1 (241764)
Length:
4157
CDS:
1596..4142

Additional Resources:

NCBI RefSeq record:
XM_011239542.2
NBCI Gene record:
L3mbtl1 (241764)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011239542.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000226028 GGCATGCGGTTCCGGATAAAT pLKO_005 1938 CDS 100% 15.000 21.000 N L3mbtl1 n/a
2 TRCN0000254691 ACGCGCCACTGAACATGATAG pLKO_005 1963 CDS 100% 10.800 15.120 N L3mbtl1 n/a
3 TRCN0000254693 CTCCAAAGTATCGCAAGATTC pLKO_005 3682 CDS 100% 10.800 15.120 N L3mbtl1 n/a
4 TRCN0000254692 ATGGCTGGAGTCACAATTATG pLKO_005 3268 CDS 100% 13.200 10.560 N L3mbtl1 n/a
5 TRCN0000226027 GAACCCGTAACAGCTACTATT pLKO_005 1830 CDS 100% 13.200 10.560 N L3mbtl1 n/a
6 TRCN0000218170 GAAGAAGAACCCGTCTAATTT pLKO_005 3617 CDS 100% 15.000 10.500 N L3mbtl1 n/a
7 TRCN0000254694 CCACACAAAGACCTCCAAATA pLKO_005 3437 CDS 100% 13.200 9.240 N L3mbtl1 n/a
8 TRCN0000226026 TGCCTACAACCGCCTTCATTA pLKO_005 1705 CDS 100% 13.200 9.240 N L3mbtl1 n/a
9 TRCN0000226029 TGTGGAGGATCATCGGATAAA pLKO_005 3236 CDS 100% 13.200 9.240 N L3mbtl1 n/a
10 TRCN0000265593 ACCAGGACCGTCAAGATATAA pLKO_005 2068 CDS 100% 15.000 9.000 N L3mbtl1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011239542.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.