Transcript: Mouse XM_011241398.1

PREDICTED: Mus musculus cat eye syndrome chromosome region, candidate 2 (Cecr2), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cecr2 (330409)
Length:
8837
CDS:
263..4060

Additional Resources:

NCBI RefSeq record:
XM_011241398.1
NBCI Gene record:
Cecr2 (330409)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011241398.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000239057 AGCATGTGCAGGTCGAAATAA pLKO_005 7450 3UTR 100% 15.000 21.000 N Cecr2 n/a
2 TRCN0000239056 TAGATCTCGACAACCATAATG pLKO_005 3552 CDS 100% 13.200 18.480 N Cecr2 n/a
3 TRCN0000239054 GCTACTTGGAAGATATCATTA pLKO_005 501 CDS 100% 13.200 10.560 N Cecr2 n/a
4 TRCN0000239053 AGCTACAGGAGGAGATTATAT pLKO_005 888 CDS 100% 15.000 10.500 N Cecr2 n/a
5 TRCN0000239055 CCAACTATTACCAGATTATTA pLKO_005 1608 CDS 100% 15.000 10.500 N Cecr2 n/a
6 TRCN0000240763 ACTTCGAGATCGAGGAGTTAG pLKO_005 375 CDS 100% 10.800 7.560 N CECR2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011241398.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.