Transcript: Mouse XM_011243781.1

PREDICTED: Mus musculus HORMA domain containing 2 (Hormad2), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Hormad2 (75828)
Length:
1805
CDS:
124..1044

Additional Resources:

NCBI RefSeq record:
XM_011243781.1
NBCI Gene record:
Hormad2 (75828)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011243781.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000218532 ATACCTACACATGGCAGTATT pLKO_005 414 CDS 100% 13.200 18.480 N Hormad2 n/a
2 TRCN0000225766 TTCCCTACTAATCCGTCAATT pLKO_005 588 CDS 100% 13.200 18.480 N Hormad2 n/a
3 TRCN0000225764 TTCCCGTCCCAAGTGACAAAT pLKO_005 184 CDS 100% 13.200 9.240 N Hormad2 n/a
4 TRCN0000376270 AGAACACTGAAGGCGTCTAAG pLKO_005 154 CDS 100% 10.800 7.560 N Hormad2 n/a
5 TRCN0000376369 TCCGAATGATGTTATACTTAC pLKO_005 639 CDS 100% 10.800 7.560 N Hormad2 n/a
6 TRCN0000257256 GGTGCCTTTGCTACACCTGTT pLKO_005 1051 3UTR 100% 4.050 2.835 N Hormad2 n/a
7 TRCN0000225765 CTACTTGTATCTCATGTATAA pLKO_005 242 CDS 100% 13.200 7.920 N Hormad2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011243781.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.