Transcript: Mouse XM_011246110.2

PREDICTED: Mus musculus C2 calcium-dependent domain containing 2 (C2cd2), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
C2cd2 (207781)
Length:
2305
CDS:
336..2267

Additional Resources:

NCBI RefSeq record:
XM_011246110.2
NBCI Gene record:
C2cd2 (207781)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011246110.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263412 CCATTCACCTGGACCTATTTA pLKO_005 1357 CDS 100% 15.000 21.000 N C2cd2 n/a
2 TRCN0000263411 CCGTCACAGTGAAGGTCATTG pLKO_005 1657 CDS 100% 10.800 7.560 N C2cd2 n/a
3 TRCN0000282612 GAGCTATGAAGAAGCATAAAG pLKO_005 2185 CDS 100% 13.200 7.920 N C2cd2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011246110.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.