Transcript: Mouse XM_011246178.2

PREDICTED: Mus musculus T cell activation GTPase activating protein 1 (Tagap1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tagap1 (380608)
Length:
2775
CDS:
866..2002

Additional Resources:

NCBI RefSeq record:
XM_011246178.2
NBCI Gene record:
Tagap1 (380608)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011246178.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000254905 ATGCATTCTGTCAGTAGTAAC pLKO_005 2540 3UTR 100% 10.800 6.480 N Tagap1 n/a
2 TRCN0000254904 CTTACGAAGAGGCCATTTATT pLKO_005 1638 CDS 100% 15.000 7.500 Y Tagap1 n/a
3 TRCN0000254903 GACAACTGCTTTGAGATATTT pLKO_005 668 5UTR 100% 15.000 7.500 Y Tagap1 n/a
4 TRCN0000254906 GTGCTAGAGAATCCTACATTT pLKO_005 1980 CDS 100% 13.200 6.600 Y Tagap1 n/a
5 TRCN0000254902 ACGTTCCAGTTAGTGGATATG pLKO_005 1595 CDS 100% 10.800 5.400 Y Tagap1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011246178.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.