Transcript: Mouse XM_011249685.1

PREDICTED: Mus musculus predicted gene 5150 (Gm5150), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gm5150 (381484)
Length:
991
CDS:
50..901

Additional Resources:

NCBI RefSeq record:
XM_011249685.1
NBCI Gene record:
Gm5150 (381484)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011249685.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000265163 CACAGGAGAAACTTGATATAT pLKO_005 260 CDS 100% 15.000 10.500 N Gm5150 n/a
2 TRCN0000251208 ATCCTGCTGCTGGGACTTAAA pLKO_005 101 CDS 100% 13.200 7.920 N Gm5150 n/a
3 TRCN0000251209 GACCATCAGAGTCTGACATTG pLKO_005 777 CDS 100% 10.800 6.480 N Gm5150 n/a
4 TRCN0000251210 TTTCTATCTGCATCAGTTATG pLKO_005 351 CDS 100% 10.800 6.480 N Gm5150 n/a
5 TRCN0000258151 GACCATCAGAGCCTGACATTG pLKO_005 420 CDS 100% 10.800 5.400 Y Gm5150 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011249685.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.