Transcript: Mouse XM_011250349.1

PREDICTED: Mus musculus von Willebrand factor A domain containing 5B1 (Vwa5b1), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Vwa5b1 (75718)
Length:
8566
CDS:
81..3728

Additional Resources:

NCBI RefSeq record:
XM_011250349.1
NBCI Gene record:
Vwa5b1 (75718)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011250349.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000251611 TGATCTGCAGACCCTACTTAA pLKO_005 2168 CDS 100% 13.200 18.480 N Vwa5b1 n/a
2 TRCN0000251609 TGTATCCAATAGACGAGTATA pLKO_005 229 CDS 100% 13.200 18.480 N Vwa5b1 n/a
3 TRCN0000251608 CAGACCAAGGACTCCTATAAC pLKO_005 645 CDS 100% 13.200 9.240 N Vwa5b1 n/a
4 TRCN0000251607 TGCAACCAAAGATGGTCAAAT pLKO_005 1618 CDS 100% 13.200 9.240 N Vwa5b1 n/a
5 TRCN0000251610 TCTGCTACCGACTGGTCAAAG pLKO_005 1543 CDS 100% 10.800 7.560 N Vwa5b1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011250349.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.