Transcript: Human XM_011510220.2

PREDICTED: Homo sapiens DENN domain containing 4B (DENND4B), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DENND4B (9909)
Length:
5508
CDS:
537..4712

Additional Resources:

NCBI RefSeq record:
XM_011510220.2
NBCI Gene record:
DENND4B (9909)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011510220.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000344361 ATGTCATTCTCCACCAATAAT pLKO_005 5107 3UTR 100% 15.000 12.000 N DENND4B n/a
2 TRCN0000253701 GGAATCTACCGTGAGATATTA pLKO_005 4503 CDS 100% 15.000 10.500 N DENND4B n/a
3 TRCN0000344277 CACCTATGGCTACTACAATAA pLKO_005 2768 CDS 100% 13.200 9.240 N DENND4B n/a
4 TRCN0000253699 GAGGGCACTCCTCATACTTAC pLKO_005 908 CDS 100% 10.800 7.560 N DENND4B n/a
5 TRCN0000253700 GGACATAGTGGCCTTCGATAA pLKO_005 4559 CDS 100% 10.800 7.560 N DENND4B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011510220.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.