Transcript: Human XM_011512425.3

PREDICTED: Homo sapiens collagen type VI alpha 6 chain (COL6A6), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
COL6A6 (131873)
Length:
9902
CDS:
371..7162

Additional Resources:

NCBI RefSeq record:
XM_011512425.3
NBCI Gene record:
COL6A6 (131873)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011512425.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000256620 TGAAGCTCAGGACATAGTAAA pLKO_005 2566 CDS 100% 13.200 18.480 N COL6A6 n/a
2 TRCN0000256617 CTTCGGCAAGAAGGTGTAATC pLKO_005 2603 CDS 100% 10.800 15.120 N COL6A6 n/a
3 TRCN0000256616 GCCATGGGTGGCAGTACTTAT pLKO_005 3011 CDS 100% 13.200 10.560 N COL6A6 n/a
4 TRCN0000256618 CCCTGCATTCATTGGTATTAA pLKO_005 7279 3UTR 100% 15.000 10.500 N COL6A6 n/a
5 TRCN0000256619 ATGAACTGAAGAAGGTCAATA pLKO_005 3855 CDS 100% 13.200 9.240 N COL6A6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011512425.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.