Transcript: Human XM_011513123.2

PREDICTED: Homo sapiens ATPase 13A3 (ATP13A3), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ATP13A3 (79572)
Length:
7455
CDS:
530..4210

Additional Resources:

NCBI RefSeq record:
XM_011513123.2
NBCI Gene record:
ATP13A3 (79572)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011513123.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000242969 GACCACCTTCGGGTCTTATAT pLKO_005 3516 CDS 100% 15.000 21.000 N ATP13A3 n/a
2 TRCN0000242971 TCGTTACAAATGAGCATATTT pLKO_005 5332 3UTR 100% 15.000 12.000 N ATP13A3 n/a
3 TRCN0000242968 ATCACAACAGATTCGTTATTT pLKO_005 928 CDS 100% 15.000 10.500 N ATP13A3 n/a
4 TRCN0000242970 CAATCGTAAGCTCACTATATT pLKO_005 1263 CDS 100% 15.000 10.500 N ATP13A3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011513123.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.