Transcript: Human XM_011513872.3

PREDICTED: Homo sapiens coiled-coil and C2 domain containing 2A (CC2D2A), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CC2D2A (57545)
Length:
3321
CDS:
201..3242

Additional Resources:

NCBI RefSeq record:
XM_011513872.3
NBCI Gene record:
CC2D2A (57545)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011513872.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000253750 AGACATAGAGCGGGAACTAAT pLKO_005 837 CDS 100% 13.200 18.480 N CC2D2A n/a
2 TRCN0000253751 GTCAACTGGCCGGAGAGTTTA pLKO_005 2352 CDS 100% 13.200 10.560 N CC2D2A n/a
3 TRCN0000267579 GCCAAGCTGGCCCAGTTATAT pLKO_005 1485 CDS 100% 15.000 10.500 N CC2D2A n/a
4 TRCN0000253752 CATTGCTTAAGACTATCATAA pLKO_005 1711 CDS 100% 13.200 9.240 N CC2D2A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011513872.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.