Transcript: Human XM_011517236.2

PREDICTED: Homo sapiens fer-1 like family member 6 (FER1L6), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FER1L6 (654463)
Length:
3740
CDS:
482..3475

Additional Resources:

NCBI RefSeq record:
XM_011517236.2
NBCI Gene record:
FER1L6 (654463)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011517236.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000262871 GACCCAGATCCTCGCCATATA pLKO_005 3488 3UTR 100% 13.200 18.480 N FER1L6 n/a
2 TRCN0000262868 CACGTCCAAACCCACCGAAAT pLKO_005 2317 CDS 100% 10.800 15.120 N FER1L6 n/a
3 TRCN0000262870 CCAGTATTTGGAAGGTCATTT pLKO_005 2108 CDS 100% 13.200 9.240 N FER1L6 n/a
4 TRCN0000262869 TTGACTGGTGGTCTAAGTATT pLKO_005 1533 CDS 100% 13.200 9.240 N FER1L6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011517236.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.