Transcript: Human XM_011522475.2

PREDICTED: Homo sapiens chromosome 16 open reading frame 96 (C16orf96), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
C16orf96 (342346)
Length:
3936
CDS:
511..3936

Additional Resources:

NCBI RefSeq record:
XM_011522475.2
NBCI Gene record:
C16orf96 (342346)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011522475.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000370792 CAAGACTCTCCAGGCTCAAAT pLKO_005 2859 CDS 100% 13.200 9.240 N C16orf96 n/a
2 TRCN0000370791 CTGAACCAGCGCTTGAGTTAT pLKO_005 2641 CDS 100% 13.200 9.240 N C16orf96 n/a
3 TRCN0000352397 GCTCGCAGCTGTCCAAGTAAA pLKO_005 1860 CDS 100% 13.200 9.240 N C16orf96 n/a
4 TRCN0000370793 TGCAGACTGTCTGGCATTATG pLKO_005 1340 CDS 100% 13.200 9.240 N C16orf96 n/a
5 TRCN0000352416 GCAACCTGTTGACGCTCTATC pLKO_005 3482 CDS 100% 10.800 7.560 N C16orf96 n/a
6 TRCN0000352389 GTGCACTCCAGTGCCCTATTT pLKO_005 3682 CDS 100% 13.200 7.920 N C16orf96 n/a
7 TRCN0000352427 TCGGGACAACAGTGGACATAT pLKO_005 2690 CDS 100% 13.200 7.920 N C16orf96 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011522475.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.