Transcript: Human XM_011525401.2

PREDICTED: Homo sapiens unk zinc finger (UNK), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
UNK (85451)
Length:
3014
CDS:
70..1632

Additional Resources:

NCBI RefSeq record:
XM_011525401.2
NBCI Gene record:
UNK (85451)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011525401.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000253768 CAGTCGGTGAAATGCCTTAAG pLKO_005 1492 CDS 100% 10.800 7.560 N UNK n/a
2 TRCN0000253767 CTACCAGGCTGGTACTCATTC pLKO_005 2473 3UTR 100% 10.800 7.560 N UNK n/a
3 TRCN0000328116 TCAGCATCACATGGATCTTTG pLKO_005 1015 CDS 100% 10.800 7.560 N Unk n/a
4 TRCN0000253771 CCTGGAGAAGACTTTCGATAA pLKO_005 792 CDS 100% 10.800 6.480 N UNK n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011525401.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.