Transcript: Human XM_011527758.2

PREDICTED: Homo sapiens ankyrin repeat domain 24 (ANKRD24), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ANKRD24 (170961)
Length:
4044
CDS:
52..3735

Additional Resources:

NCBI RefSeq record:
XM_011527758.2
NBCI Gene record:
ANKRD24 (170961)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011527758.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000265421 GCGTCATCTCAGAACTCTATG pLKO_005 958 CDS 100% 10.800 15.120 N ANKRD24 n/a
2 TRCN0000253740 TTGGCTTCACTTGGCCCTATC pLKO_005 3819 3UTR 100% 6.000 4.800 N ANKRD24 n/a
3 TRCN0000253742 CAAAGAAGTCTTCAATCTTAA pLKO_005 3480 CDS 100% 13.200 9.240 N ANKRD24 n/a
4 TRCN0000253741 CAACCCACATGGAGCTAAATG pLKO_005 1916 CDS 100% 13.200 9.240 N ANKRD24 n/a
5 TRCN0000253739 GTGACCAGGTGAAGGATTTAC pLKO_005 3557 CDS 100% 13.200 9.240 N ANKRD24 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011527758.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.