Transcript: Human XM_011534142.3

PREDICTED: Homo sapiens glutamate receptor interacting protein 2 (GRIP2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GRIP2 (80852)
Length:
11721
CDS:
15..3161

Additional Resources:

NCBI RefSeq record:
XM_011534142.3
NBCI Gene record:
GRIP2 (80852)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011534142.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000236727 GCTACTGGCCATTGACAATAT pLKO_005 1844 CDS 100% 13.200 18.480 N GRIP2 n/a
2 TRCN0000236724 ACCGTGTCCTGTCCATCAATG pLKO_005 1546 CDS 100% 10.800 15.120 N GRIP2 n/a
3 TRCN0000236726 CTGAACATTGGTGACTATATT pLKO_005 297 CDS 100% 15.000 10.500 N GRIP2 n/a
4 TRCN0000236728 GGACCCTTGATGGTGGAAATA pLKO_005 762 CDS 100% 13.200 9.240 N GRIP2 n/a
5 TRCN0000236725 ATGAGTCCTCGAACTACAATG pLKO_005 1275 CDS 100% 10.800 7.560 N GRIP2 n/a
6 TRCN0000360057 CCTCTACAAGGAGGGCAATAG pLKO_005 479 CDS 100% 10.800 7.560 N GRIP2 n/a
7 TRCN0000360059 TCATCTCCGACATCAAGAAAG pLKO_005 1780 CDS 100% 10.800 7.560 N GRIP2 n/a
8 TRCN0000359989 CCGTCACACTGAAGATCAAGA pLKO_005 2215 CDS 100% 4.950 3.465 N GRIP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011534142.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.