Transcript: Human XM_011538331.3

PREDICTED: Homo sapiens transmembrane protein 233 (TMEM233), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TMEM233 (387890)
Length:
2294
CDS:
1721..2065

Additional Resources:

NCBI RefSeq record:
XM_011538331.3
NBCI Gene record:
TMEM233 (387890)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011538331.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000353050 ACAACGATGGAGACTACGAAG pLKO_005 1920 CDS 100% 4.050 5.670 N TMEM233 n/a
2 TRCN0000344204 GCCTTCTCATCATCGGCATTT pLKO_005 1998 CDS 100% 10.800 8.640 N TMEM233 n/a
3 TRCN0000344153 CCCATCAACATCGTGGCTTTG pLKO_005 1871 CDS 100% 6.000 4.200 N TMEM233 n/a
4 TRCN0000344203 GCTCACCATCGTCTCGTGTTT pLKO_005 1837 CDS 100% 4.950 3.465 N TMEM233 n/a
5 TRCN0000279317 TGTCTCTGAACAGCTACAATG pLKO_005 1905 CDS 100% 10.800 7.560 N Tmem233 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011538331.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.