Transcript: Human XM_011541829.1

PREDICTED: Homo sapiens dispatched RND transporter family member 3 (DISP3), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DISP3 (57540)
Length:
4189
CDS:
227..3292

Additional Resources:

NCBI RefSeq record:
XM_011541829.1
NBCI Gene record:
DISP3 (57540)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011541829.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000246025 TTGTGGTCTTCGGCATTATTG pLKO_005 2148 CDS 100% 13.200 9.240 N DISP3 n/a
2 TRCN0000246027 AGCTTTCCTCATGGATCTAAG pLKO_005 4015 3UTR 100% 10.800 7.560 N DISP3 n/a
3 TRCN0000246029 AGGAACAACGGGCTAAGTTTC pLKO_005 360 CDS 100% 10.800 7.560 N DISP3 n/a
4 TRCN0000246028 TGCGCAGTGAGATCCTGTTTG pLKO_005 297 CDS 100% 10.800 7.560 N DISP3 n/a
5 TRCN0000246026 GAGCACTGGAAGCAGATATTC pLKO_005 2615 CDS 100% 13.200 7.920 N DISP3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011541829.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.