Transcript: Human XM_017002485.1

PREDICTED: Homo sapiens synapse defective Rho GTPase homolog 2 (SYDE2), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SYDE2 (84144)
Length:
3449
CDS:
211..3021

Additional Resources:

NCBI RefSeq record:
XM_017002485.1
NBCI Gene record:
SYDE2 (84144)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017002485.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000247675 TAGTAGGCCTGTATCGATTAT pLKO_005 1982 CDS 100% 13.200 18.480 N SYDE2 n/a
2 TRCN0000247672 AGCCGAAAGCTAAGCGTTAAG pLKO_005 1054 CDS 100% 10.800 15.120 N SYDE2 n/a
3 TRCN0000247673 AGGTGTTCTTAAGGATTATTT pLKO_005 2106 CDS 100% 15.000 10.500 N SYDE2 n/a
4 TRCN0000247674 CTTGGACTTCTTGGGATATTT pLKO_005 3229 3UTR 100% 15.000 10.500 N SYDE2 n/a
5 TRCN0000247676 CCGAACATGCAGGTGATATTC pLKO_005 713 CDS 100% 13.200 9.240 N SYDE2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017002485.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.