Transcript: Human XM_017011770.2

PREDICTED: Homo sapiens C-type lectin domain family 2 member L (CLEC2L), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CLEC2L (154790)
Length:
1246
CDS:
205..597

Additional Resources:

NCBI RefSeq record:
XM_017011770.2
NBCI Gene record:
CLEC2L (154790)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017011770.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000239630 CCAGAAGGAGCTGGAATTTAT pLKO_005 372 CDS 100% 15.000 10.500 N CLEC2L n/a
2 TRCN0000239628 CGTGTGGCTCAGCAGTTAAAT pLKO_005 794 3UTR 100% 15.000 10.500 N CLEC2L n/a
3 TRCN0000239626 GTGCAGCAAGATGGCCTATAC pLKO_005 573 CDS 100% 10.800 7.560 N CLEC2L n/a
4 TRCN0000240287 GTGCAGCAAGATGGCCTATAC pLKO_005 573 CDS 100% 10.800 7.560 N Clec2l n/a
5 TRCN0000239627 TGGATTGGACTACGCAGAGTT pLKO_005 418 CDS 100% 4.950 3.465 N CLEC2L n/a
6 TRCN0000239629 ACGGAAGGAAGTGCTACTTCT pLKO_005 272 CDS 100% 4.950 2.970 N CLEC2L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017011770.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.