Transcript: Human XM_017015792.1

PREDICTED: Homo sapiens transmembrane protein 273 (TMEM273), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TMEM273 (170371)
Length:
932
CDS:
245..814

Additional Resources:

NCBI RefSeq record:
XM_017015792.1
NBCI Gene record:
TMEM273 (170371)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017015792.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000370964 TGATTTCAAGTACGCCCTCAT pLKO_005 340 CDS 100% 4.050 5.670 N TMEM273 n/a
2 TRCN0000370993 GATCAGGAGGCACTTATTTGA pLKO_005 418 CDS 100% 5.625 3.938 N TMEM273 n/a
3 TRCN0000268581 ACTTATTTGACGACGACTCTT pLKO_005 429 CDS 100% 4.950 3.465 N TMEM273 n/a
4 TRCN0000370931 TCCTCTTCCTCCTGGATGTAG pLKO_005 273 CDS 100% 4.950 3.465 N TMEM273 n/a
5 TRCN0000370932 TCAAGTGCTGGCAACAGGCAA pLKO_005 301 CDS 100% 2.640 1.848 N TMEM273 n/a
6 TRCN0000370929 TGTCGCCATATCTGCTGGCTT pLKO_005 376 CDS 100% 2.640 1.848 N TMEM273 n/a
7 TRCN0000268582 GGCCCTGAAGATCTGCATGAT pLKO_005 400 CDS 100% 4.950 2.970 N TMEM273 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017015792.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.