Transcript: Human XM_017022946.1

PREDICTED: Homo sapiens solute carrier family 38 member 8 (SLC38A8), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC38A8 (146167)
Length:
1890
CDS:
466..1773

Additional Resources:

NCBI RefSeq record:
XM_017022946.1
NBCI Gene record:
SLC38A8 (146167)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017022946.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245911 TCTACTGCAGCATGCGCAAAC pLKO_005 1178 CDS 100% 6.000 8.400 N SLC38A8 n/a
2 TRCN0000245912 GTCCTACCCAGGCAATGATAT pLKO_005 1323 CDS 100% 13.200 9.240 N SLC38A8 n/a
3 TRCN0000245909 TTTGCTGTCTCCATCGTAACT pLKO_005 1369 CDS 100% 4.950 3.465 N SLC38A8 n/a
4 TRCN0000245910 TATGCCTGACCTCAGCGAGAT pLKO_005 1557 CDS 100% 4.050 2.835 N SLC38A8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017022946.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.