Transcript: Human XM_017027642.1

PREDICTED: Homo sapiens zinc finger protein 831 (ZNF831), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF831 (128611)
Length:
10798
CDS:
1395..6428

Additional Resources:

NCBI RefSeq record:
XM_017027642.1
NBCI Gene record:
ZNF831 (128611)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017027642.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230583 AGCGACGATGAAGACCGATTA pLKO_005 6393 CDS 100% 10.800 15.120 N ZNF831 n/a
2 TRCN0000218846 ACGTCAGGTATCTGGATTAAT pLKO_005 6236 CDS 100% 15.000 12.000 N ZNF831 n/a
3 TRCN0000230584 CCTGGTTACTTAGCATATATT pLKO_005 7960 3UTR 100% 15.000 10.500 N ZNF831 n/a
4 TRCN0000230582 ACGAACTGTGAAGGATATTTC pLKO_005 5570 CDS 100% 13.200 9.240 N ZNF831 n/a
5 TRCN0000230581 CCTGAAGAACGGGCATCATTT pLKO_005 4311 CDS 100% 13.200 9.240 N ZNF831 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017027642.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.