Transcript: Mouse XM_017312496.2

PREDICTED: Mus musculus U6 snRNA biogenesis 1 (Usb1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Usb1 (101985)
Length:
2396
CDS:
715..1518

Additional Resources:

NCBI RefSeq record:
XM_017312496.2
NBCI Gene record:
Usb1 (101985)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017312496.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000249931 GAATTTGACCTTACTACTTTC pLKO_005 1303 CDS 100% 10.800 15.120 N Usb1 n/a
2 TRCN0000249930 CAGGGCACAGGGTGCTAATTT pLKO_005 1979 3UTR 100% 15.000 10.500 N Usb1 n/a
3 TRCN0000249929 GCTGCAAGTCCGGGAACAAAT pLKO_005 1475 CDS 100% 13.200 9.240 N Usb1 n/a
4 TRCN0000249933 TGCCAACAGGGTAAAGATTTA pLKO_005 1182 CDS 100% 13.200 9.240 N Usb1 n/a
5 TRCN0000249932 CCTGACAGTGTGCTAAGTATG pLKO_005 856 CDS 100% 10.800 6.480 N Usb1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017312496.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.