Transcript: Mouse XM_017314698.1

PREDICTED: Mus musculus NLR family, pyrin domain containing 1B (Nlrp1b), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nlrp1b (637515)
Length:
4303
CDS:
250..3774

Additional Resources:

NCBI RefSeq record:
XM_017314698.1
NBCI Gene record:
Nlrp1b (637515)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017314698.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000255336 AGTTTGAACGGGAGGTCTATT pLKO_005 1106 CDS 100% 13.200 18.480 N Nlrp1b n/a
2 TRCN0000255335 TGATCTACTATCGAGTCAATC pLKO_005 3092 CDS 100% 10.800 15.120 N Nlrp1b n/a
3 TRCN0000255337 GGACCTAGGTTCCGTACATAT pLKO_005 4015 3UTR 100% 13.200 10.560 N Nlrp1b n/a
4 TRCN0000255334 TCAGCATGAGGGTCAACTAAA pLKO_005 294 CDS 100% 13.200 9.240 N Nlrp1b n/a
5 TRCN0000267560 GTGAAGGAGAGCGATGCAATT pLKO_005 1141 CDS 100% 10.800 7.560 N Nlrp1b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017314698.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.