Transcript: Mouse XM_017317589.2

PREDICTED: Mus musculus cramped chromatin regulator homolog 1 (Cramp1l), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Cramp1l (57354)
Length:
7431
CDS:
18..3875

Additional Resources:

NCBI RefSeq record:
XM_017317589.2
NBCI Gene record:
Cramp1l (57354)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017317589.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000239425 AGCCACCACAGTACGTTATAA pLKO_005 836 CDS 100% 15.000 21.000 N Cramp1l n/a
2 TRCN0000239423 GACTACATATCTCGGTTTAAT pLKO_005 3756 CDS 100% 15.000 21.000 N Cramp1l n/a
3 TRCN0000239424 ATAACCCTGCTATCCTATAAC pLKO_005 5446 3UTR 100% 13.200 18.480 N Cramp1l n/a
4 TRCN0000239422 ACCGCACCTGGCACAAGATTA pLKO_005 658 CDS 100% 13.200 9.240 N Cramp1l n/a
5 TRCN0000244950 GATGACAAGAATGCAACAAAG pLKO_005 792 CDS 100% 10.800 7.560 N CRAMP1 n/a
6 TRCN0000257325 GATGACAAGAATGCAACAAAG pLKO_005 792 CDS 100% 10.800 7.560 N Cramp1l n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017317589.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.