Transcript: Mouse XM_017321096.1

PREDICTED: Mus musculus tectonin beta-propeller repeat containing 1 (Tecpr1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tecpr1 (70381)
Length:
5531
CDS:
2129..4057

Additional Resources:

NCBI RefSeq record:
XM_017321096.1
NBCI Gene record:
Tecpr1 (70381)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017321096.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000268704 TCCGGTATAGGCGATACAAAT pLKO_005 609 5UTR 100% 13.200 18.480 N Tecpr1 n/a
2 TRCN0000268701 ATGGCAGTATGCCAGCGATTT pLKO_005 3235 CDS 100% 10.800 15.120 N Tecpr1 n/a
3 TRCN0000268702 TGGACCAACATTGACCTAAAG pLKO_005 2030 5UTR 100% 10.800 15.120 N Tecpr1 n/a
4 TRCN0000268752 AGCATCCTCTTCATCTATTAT pLKO_005 2504 CDS 100% 15.000 10.500 N Tecpr1 n/a
5 TRCN0000283771 TCAGGTCAGAGTCAGCCATTT pLKO_005 4166 3UTR 100% 10.800 7.560 N Tecpr1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017321096.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.