Transcript: Mouse XM_017321136.1

PREDICTED: Mus musculus testis expressed 26 (Tex26), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tex26 (75860)
Length:
598
CDS:
46..507

Additional Resources:

NCBI RefSeq record:
XM_017321136.1
NBCI Gene record:
Tex26 (75860)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017321136.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000267381 CATTGAGGCAAAGCCTAATAA pLKO_005 453 CDS 100% 15.000 10.500 N Tex26 n/a
2 TRCN0000267382 GGACACTGAATTTCGATATAA pLKO_005 138 CDS 100% 15.000 10.500 N Tex26 n/a
3 TRCN0000267384 TTCCTACAAAGACCGACAAAT pLKO_005 402 CDS 100% 13.200 9.240 N Tex26 n/a
4 TRCN0000267383 CAGATGGAGCTCTGGTTGTTT pLKO_005 518 3UTR 100% 5.625 3.938 N Tex26 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017321136.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.