Transcript: Mouse XM_017321524.1

PREDICTED: Mus musculus coiled-coil domain containing 129 (Ccdc129), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ccdc129 (232016)
Length:
4914
CDS:
1580..4684

Additional Resources:

NCBI RefSeq record:
XM_017321524.1
NBCI Gene record:
Ccdc129 (232016)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017321524.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000252550 CTAGTTTCAACTCGTGTTATT pLKO_005 1932 CDS 100% 0.000 0.000 N Ccdc129 n/a
2 TRCN0000252547 TGCACGAACAAGGAATCATTC pLKO_005 1842 CDS 100% 10.800 8.640 N Ccdc129 n/a
3 TRCN0000252548 AGAGGAGCCATGCCCTATAAA pLKO_005 3497 CDS 100% 15.000 10.500 N Ccdc129 n/a
4 TRCN0000258246 GCAGACCTAGGGACCTATAAT pLKO_005 3662 CDS 100% 15.000 10.500 N Ccdc129 n/a
5 TRCN0000252549 TACCTGAACACTGCGACAATC pLKO_005 4359 CDS 100% 0.000 0.000 N Ccdc129 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017321524.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.