Transcript: Human XM_024447136.1

PREDICTED: Homo sapiens triple QxxK/R motif containing (TRIQK), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TRIQK (286144)
Length:
3896
CDS:
544..804

Additional Resources:

NCBI RefSeq record:
XM_024447136.1
NBCI Gene record:
TRIQK (286144)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024447136.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423478 CAAATTGGTAAACAGGATTAT pLKO_005 598 CDS 100% 13.200 18.480 N TRIQK n/a
2 TRCN0000426835 ACTTCCTGTTGATCAGTACAG pLKO_005 573 CDS 100% 4.050 5.670 N TRIQK n/a
3 TRCN0000419748 TCAGACTCACCACGGATGTTG pLKO_005 755 CDS 100% 4.950 3.960 N TRIQK n/a
4 TRCN0000422829 CACTACTACTGGCTTTCTATG pLKO_005 722 CDS 100% 10.800 7.560 N TRIQK n/a
5 TRCN0000422437 TTAGCTAAGCAACAATCAATG pLKO_005 801 CDS 100% 10.800 7.560 N TRIQK n/a
6 TRCN0000414917 AGCTATATTGGCACTACTACT pLKO_005 711 CDS 100% 4.950 3.465 N TRIQK n/a
7 TRCN0000434660 CATAAAGGAAGTTGGCCTTGT pLKO_005 684 CDS 100% 4.050 2.835 N TRIQK n/a
8 TRCN0000423726 CAAATGTCATTGCCAATTTAT pLKO_005 1087 3UTR 100% 15.000 9.000 N TRIQK n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024447136.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.