Transcript: Human XM_024450844.1

PREDICTED: Homo sapiens BAH domain and coiled-coil containing 1 (BAHCC1), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BAHCC1 (57597)
Length:
10265
CDS:
413..7756

Additional Resources:

NCBI RefSeq record:
XM_024450844.1
NBCI Gene record:
BAHCC1 (57597)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024450844.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000377646 AGGGCGCATCTGAGCAAATAT pLKO_005 7855 3UTR 100% 15.000 12.000 N BAHCC1 n/a
2 TRCN0000230988 ATTGTATCTGCTGAATCATAT pLKO_005 8643 3UTR 100% 13.200 10.560 N BAHCC1 n/a
3 TRCN0000253842 AGCGTGGCCACACCCATATTT pLKO_005 6356 CDS 100% 15.000 10.500 N BAHCC1 n/a
4 TRCN0000217993 CATGAAGAACCTGCTCAAATA pLKO_005 1732 CDS 100% 13.200 9.240 N BAHCC1 n/a
5 TRCN0000371000 GACTCAGTAGTGGTGGAATTT pLKO_005 5864 CDS 100% 13.200 9.240 N BAHCC1 n/a
6 TRCN0000230986 TGCAGCCACCCGACATCTATA pLKO_005 5634 CDS 100% 13.200 9.240 N BAHCC1 n/a
7 TRCN0000230987 GCAAAGACAAAGCTGGTAAAG pLKO_005 6117 CDS 100% 10.800 7.560 N BAHCC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024450844.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.