Transcript: Human XM_024451651.1

PREDICTED: Homo sapiens arrestin domain containing 5 (ARRDC5), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ARRDC5 (645432)
Length:
799
CDS:
138..752

Additional Resources:

NCBI RefSeq record:
XM_024451651.1
NBCI Gene record:
ARRDC5 (645432)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024451651.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000262392 ATGCATCAAGACGGTCGTATT pLKO_005 374 CDS 100% 10.800 15.120 N ARRDC5 n/a
2 TRCN0000282218 TGTCAGAGGACGGAGTGTTAC pLKO_005 706 CDS 100% 10.800 15.120 N ARRDC5 n/a
3 TRCN0000267587 CCACACCTTTGACTTCCATTT pLKO_005 41 5UTR 100% 10.800 7.560 N Arrdc5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024451651.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.