Transcript: Human XM_024452201.1

PREDICTED: Homo sapiens glutathione S-transferase theta 4 (GSTT4), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GSTT4 (25774)
Length:
1480
CDS:
372..914

Additional Resources:

NCBI RefSeq record:
XM_024452201.1
NBCI Gene record:
GSTT4 (25774)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024452201.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000147904 GCCTCAAAGATGGGAAATTTA pLKO.1 279 5UTR 100% 15.000 7.500 Y GSTT4 n/a
2 TRCN0000146665 CATCCAGTTCAACTTTCAGTT pLKO.1 187 5UTR 100% 4.950 2.475 Y GSTT4 n/a
3 TRCN0000148835 CTTCTCGAAGAAGCATGACAT pLKO.1 169 5UTR 100% 4.950 2.475 Y GSTT4 n/a
4 TRCN0000147785 GATTCAATGGTCAAGGAGAAT pLKO.1 864 CDS 100% 4.950 2.475 Y GSTT4 n/a
5 TRCN0000146333 CAACTTTCAGTTTGTGGATCT pLKO.1 196 5UTR 100% 4.050 2.025 Y GSTT4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024452201.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.