Transcript: Human XM_024452908.1

PREDICTED: Homo sapiens forkhead associated phosphopeptide binding domain 1 (FHAD1), transcript variant X24, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FHAD1 (114827)
Length:
4717
CDS:
154..4431

Additional Resources:

NCBI RefSeq record:
XM_024452908.1
NBCI Gene record:
FHAD1 (114827)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024452908.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000265435 TGAACTTCGAGCGCGAATTAA pLKO_005 3735 CDS 100% 15.000 21.000 N FHAD1 n/a
2 TRCN0000253814 GCGCGCTCACCAGATCATAAA pLKO_005 3769 CDS 100% 13.200 10.560 N FHAD1 n/a
3 TRCN0000253813 CCAAATACAAAGACGTCATAA pLKO_005 944 CDS 100% 13.200 9.240 N FHAD1 n/a
4 TRCN0000253815 GGAACAGAGAGAGCGTCATTA pLKO_005 1628 CDS 100% 13.200 9.240 N FHAD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024452908.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.