Transcript: Mouse XM_030248785.1

PREDICTED: Mus musculus family with sequence similarity 186, member A (Fam186a), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Fam186a (72277)
Length:
9303
CDS:
147..9197

Additional Resources:

NCBI RefSeq record:
XM_030248785.1
NBCI Gene record:
Fam186a (72277)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_030248785.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000268125 TACGTCAAGCTACCCAATAAT pLKO_005 9035 CDS 100% 15.000 21.000 N Fam186a n/a
2 TRCN0000268186 TTAGACATTCAGTCGACCTTC pLKO_005 9126 CDS 100% 4.050 5.670 N Fam186a n/a
3 TRCN0000268123 GCCGGTCTTGGAGTTATTAAT pLKO_005 8936 CDS 100% 15.000 12.000 N Fam186a n/a
4 TRCN0000268122 AGATACCCGGATTTACCAAAC pLKO_005 8908 CDS 100% 6.000 4.200 N Fam186a n/a
5 TRCN0000268124 ACACTCGGACAAGCTTCAGTG pLKO_005 8988 CDS 100% 4.050 2.835 N Fam186a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_030248785.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.