Transcript: Mouse XR_001780453.2

PREDICTED: Mus musculus echinoderm microtubule associated protein like 5 (Eml5), transcript variant X6, misc_RNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Eml5 (319670)
Length:
7601
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001780453.2
NBCI Gene record:
Eml5 (319670)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001780453.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000251135 GGTTATGACTGTCGAAGTAAT pLKO_005 2542 3UTR 100% 13.200 18.480 N Eml5 n/a
2 TRCN0000413817 GGTTATGACTGTCGAAGTAAT pLKO_005 2542 3UTR 100% 13.200 18.480 N EML5 n/a
3 TRCN0000251137 CATTAGGGCATGGTCATATTT pLKO_005 3377 3UTR 100% 15.000 12.000 N Eml5 n/a
4 TRCN0000251136 CCTCAAGACCTATGCTATAAA pLKO_005 3288 3UTR 100% 15.000 10.500 N Eml5 n/a
5 TRCN0000251138 GCAGTACATGGCTACTATATT pLKO_005 6941 3UTR 100% 15.000 10.500 N Eml5 n/a
6 TRCN0000251139 TGGAGTTGCTCAGCGTTATAA pLKO_005 1788 3UTR 100% 15.000 10.500 N Eml5 n/a
7 TRCN0000412598 ATGATTATCAGTGGGTTATTT pLKO_005 2201 3UTR 100% 15.000 10.500 N EML5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001780453.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.